Essay Database

Need an original paper?
Like us on Facebook in March and win FREE subscription to THOUSANDS high-quality essays and term papers
Like us on Facebook in March and win FREE subscription to THOUSANDS high-quality essays and term papers

Bacterial Pathogens in FoodWaterborne Disease The Pediatric Bulletin Myrna R. Nieves, MD FAAP

Date Submitted: 03/26/2004 22:26:28
Category: / Science & Technology / Biology
Length: 17 pages (4724 words)
Bacterial Pathogens in FoodWaterborne Disease The Pediatric Bulletin Myrna R. Nieves, MD FAAP http://home.coqui.net/myrna/food.htm (10/03/04) SHIGELLA Shigella spp. were the second most common cause of bacterial foodborne illnesses reported by the CDC from 1983 to 1987 and the leading cause in bacterial waterborne outbreaks during 1986 to 1992 in the US. There are four species: Shigella dysenteriae, Shigella flexneri, Shigella boydii, and Shigella sonnei. Although this pathogen has been reported in contaminated food and …
Is this Essay helpful? Join now to read this particular paper
and access over 480,000 just like this GET BETTER GRADES
…the ELISA plate and binds via the biotin-streptavidin interaction. Detection of the bound complex is accomplished via a simple alkaline phosphatase labeled antibody directed against digoxigenin, with color developed using a suitable substrate (Sethabutr et al, 2000). Forward primer H8 GTTCCTTGACCGCCTTTCCGATACCGTC Reverse primer H15 GCCGGTCAGCCACCCTCTGAGAGTAC ( Sethabutr et al., 2000 ) 4. Other Types of Diagnostic Tests: No other tests available here. Updated: 2001 The Hastings & Prince Edward Counties Health Unit http://www.hpechu.on.ca/Topics/InfectiousDiseases/shigella.htm (10/03/04)
Need a custom written paper? Let our professional writers save your time.